pGEX-6P1 Bacterial Expression Vector
Catalog number :AT1664
Bacterial vector for expressing GST fusion proteins with a PreScission protease site.
- Overview
- Description
- pGEX-6P-1 Bacterial Expression Vector
- Properties
- Form
- 5 µg vector supplied in 10 mM Tris, 1 mM EDTA pH 8.0.
Application High-level, inducible expression in Bacterial Bacterial Resistance Ampicillin 5′ sequencing primer pGEX5': GGGCTGGCAAGCCACGTTTGGTG 3′ sequencing primer pGEX3': CCGGGAGCTGCATGTGTCAGAGG Promoter tac promoter Protein Tag an N-terminal GST tag Cloning Method Restriction Enzyme ⁄ MCS Delivery Type Transformation Selection Agent (Eukaryotic) NO Eukaryotic Resistance NO
- Structure Image
- Applications
- Map of Plasmid
- See restriction sites, features, and translations:Sequence Author: GE Healthcare
Related Products
Reviews
loading...