CoIP, ChIP, CUT&RUN, CUT&Tag Expert! My Basket (...)
Worldwide delivery!
Having the Best Alpaca Nanobody Products!
Home | About us | Contact us | How to order |
    My Base Info
    Shopping Basket
    My Orders
    My Shipping Info
    Modify Password
    Log Out

    Smart-RIP™ RIP Kit

    Catalog number :RIP-1001
    loading...
    RNA-RBP Immunoprecipitation, RIP

    95% of the human genome does not actually encode proteins, but produces a large number of non coding RNAs. These RNAs play an important role in regulating the growth and development of life, are closely related to AIDS virus/AIDS, leukemia, diabetes and other diseases, and participate in the regulation of stem cell development and epigenetics. RNA protein complexes drive post transcriptional regulation of gene expression in almost all cellular processes, including splicing, nuclear output, mRNA stability, and protein translation. Therefore, the understanding of post transcriptional regulatory networks and mechanisms depends on identifying changes in RNA binding during these processes.
     
    The study of the interaction between RNA and protein is receiving increasing attention from scientists and has become a hot topic in epigenetic research.
     
    RIP (RNA Binding Protein Immunoprecipitation Assay) is an RNA binding protein immunoprecipitation assay. The principle is that the RNA binding proteins (RBPs) protein RNA complex is captured by RBP specific antibodies, and then the antibody protein RNA complex is enriched by Protein A/G magnetic beads. After washing, the target RNA is finally eluted and purified to obtain RNA. The downstream is connected to conventional standard PCR, fluorescence quantitative PCR or library construction, and high-throughput second-generation sequencing is performed. It is a technique used for in vivo In Vivo detection of RNA binding proteins (RBPs) protein RNA fragment interactions.
    Overview
    Description
    RNA-RBP Immunoprecipitation kit, RIP kit
    Product Picture
    RIP
    Applications
    Highlights
    1. This reagent kit is suitable for adherent cells, suspended cells, animal tissues, and plant tissues.

    2. This kit contains RIPs suitable for cytoplasmic RNA RBP interactions and nuclear RNA RBP interactions.

    3. This reagent kit is suitable for classic Native RIP and Crosslink cross-linking RIP (for particularly fragile RNA RBP interactions).

    4. This kit is suitable for downstream experiments (RT-PCR, RT qPCR, and transcriptome NGS second-generation sequencing).

    5. This manual is a comprehensive technical manual for RIP experiments. It also includes the basic knowledge and context of epigenetics, summarizing detailed information on the interaction between RNA and various proteins.
    Work Flow Image
    RIP
    Results Display
    RIP

    Ribonucleoprotein Immunoprecipitation (RIP) Analysis

    A. Schematic of the ribonucleoprotein immunoprecipitation (RIP) assay protocol.

    B. The association of the RBP NF90 (used here as example) with ACTB and BAFF mRNAs was tested by RIP analysis using anti-NF90 antibody. Following RNA extraction, the abundance of BAFF and ACTB mRNAs in NF90 IP and IgG IP control samples was assessed by RT-qPCR analysis using mRNA-specific primers (ACTB: CATGTACGTTGCTATCCAGGC and CTCCTTAATGTCACGCACGAT; BAFF: CACAATTCAAAGGGGCAGTAA and ACTGAAAAGGAGGGAGTGCAT; UBC: ATTTGGGTCGCGGTTCTTG and TGCCTTGACATTCTCGATGGT). These results were normalized to the levels of UBC mRNA in each sample, and then plotted as the enrichment of mRNAs in the NF90 IP relative to the BAFF and ACTB mRNA levels observed in the IgG IP samples.

    C. After IP using anti-NF90 or IgG antibodies, the presence of NF90 in the IP material was confirmed by Western blot analysis.

    Related Products

    Reviews

    loading...
    Content *:
    Customer Review :
    Verification Code * :
    refresh image

    Shipping and Paying Info
    ......
    Order Information
    You can place an order online step by step as blow.

    Step 1. Register for a new account and Log in, Find out your product by searching our website.
    Step 2. Add the Product into your shopping basket, select your settlement currency.
    Step 3. Checkout by Paypal, Pay by credit card or bank transfer for your order.
    Step 4. Ship the goods for you, providing you package tracking numbers. 

    Any questions, please contact us via email: sale@engibodybio.com
    Payments by
    All our products are For Research Use Only. Not for diagnostic or therapeutic usages.